4/16: Translation

Proteins are polymers of amino acids. 

A string of amino acids is called a polypeptide.

The amino acids are held together by polypeptide bonds.

Amino acids are represented by three letter codes: Asn stands for asparagine. Gly stands for glycine.

All proteins are composed of various combinations of the 20 amino acids found in nature

Protein’s shape depends on its sequence of amino acids, it’s essential that the cell be able to translate the information in RNA into the sequence of amino acids that defines a protein’s form and function.

Let’s think about what you just did.

The two-word answer is written in our 26 letter English alphabet. But the answer was encoded using just four letters: A, U, C, and G. The way that four letters were able to represent our 26-letter alphabet was to have 3-letter combinations of A, U, C and G code for one letter of our alphabet. 

Cells use this same coding system to translate messenger RNA nucleotide sequences into the amino acid sequences of proteins.

Three mRNA nucleotides are called a codon. Codon means “codes one.”  (one amino acid)

In the example above, the first codon is AUG, and it codes for the amino acid methionine (Met) and so on.

Ribosomes are protein factories capable of reading mRNA instructions

The ribosome is made of two subunits which attach during the process of protein synthesis, then detach after the process is finished.

Transfer RNAs (tRNAs) bring amino acids to the ribosome.

On the bottom of the tRNA is an anti-codon: 3 RNA nucleotides that complement the codons in RNA

The top of the tRNA has an amino acid binding site.

During translation, ribosomes “read” the mRNA, translating the sequence of codons in the mRNA into a sequence of amino acids in a protein.

The ribosome (rRNA) is wrapped around the mRNA to exposes the mRNA codons to the cytoplasm. The tRNA in the “A” site has just entered the ribosome. 

The tRNA in the “P” site is holding on to the growing polypeptide.

The “E” site is the exit site. After a tRNA has “donated” its amino acid to the growing polypeptide, it moves to the E site, and then leaves the ribosome.

Genetic code dictionaries let you translate sequences of RNA into sequences of amino acids

if you’re given a sequence of mRNA, you can use a genetic code dictionary to figure out what amino acid sequence that mRNA is coding for.

AUGGUCAAGGUUCUCGAUGCAGUCGU

The first step is to find the start codon, AUG. In cells, AUG signals to ribosomes (the cell’s protein factories) where to start translating mRNA into protein.

Next, divide the mRNA into codons (groups of three RNA nucleotides). 

mRNA AUG GUC AAG GUU CUC GAU GCA GUC CGU

The next step is to look up each codon in a Genetic Code dictionary. 

The inner ring (yellow) represents the first nucleotide in a codon.

The second ring (light orange) represents the second nucleotide

The third ring (orange/red) represents the third nucleotide

The fourth ring (light blue) tells you the amino acid

The last ring (green) gives you the three-letter abbreviation for the amino acid.